Amplification & Préparation des librairies pour le séquençage Illumina

Echantillonnage

Un échantillonnage complet a été effectué sur les stations MAC1, RBA5 et PJDA6. Au sein des populations correspondantes, 10 individus ont été choisis en fonction de leurs pourcentages de surface nécrosée estimés visuellement sur le terrain. Les sols rhizosphériques de ces individus ont été échantillonnés dans des tubes de 2 ml en 3 réplicas. Du sol contrôle à l’écart des plantes (‘bulk soil’) a également été prélevé pour chaque station en 3 réplicas. L’échantillonnage réalisé sur les deux statons de l’île Longue était à titre exploratoire et a consisté à regrouper le sol rhizosphérique de deux individus sur la station LON10, et de trois individus sur LON 30. Du bulk soil a aussi été prélevé sur LON10. Les échantillons de sol ont été congelés au plus vite et conservés à -20°C. Afin d’avoir suffisamment de matériel et qu’il soit homogène, pour chaque individu et chaque bulk soil, les trois réplicas d’échantillonnage ont été regroupés et ces échantillons composites ont été utilisés pour les extractions d’ADN et les analyses élémentaires.

Un sous-échantillon des échantillons de sols rhizosphériques et de bulk soils a servi à effectuer les analyses physico-chimiques des sols au niveau populationnel au Laboratoire d’Analyse des Sols d’Arras (LAS, INRA). Par ailleurs, un souséchantillon des échantillons de sols rhizosphériques au niveau de la plante individuelle et des échantillons de bulk soil a permis d’effectuer les analyses de Carbone organique/N total (C/N) au laboratoire ECOBIO. Nous avons utilisé ces résultats combinés aux données de terrain pour la description des stations ci-dessus (Partie 2-1). Chaque individu de L. kerguelensis dont le sol rhizosphérique a été échantillonné a fait l’objet de prise d’images calibrées sur le terrain en vue d’une étude photométrique. Les images ont été traitées selon une méthode utilisant le logiciel ArcGis 10.6.1 pour déterminer précisément les pourcentages de surfaces nécrosées (Dorey T., 2017a).

Extraction d’ADN

A partir de chaque échantillon composite, 500 mg de sol ont été pesés en 3 réplicas techniques d’extraction d’ADN pour chaque individu et chaque bulk soil. Les extractions ont été effectuées selon le protocole décrit par (Griffiths et al., 2000). Dans un premier temps, une étape de lyse chimique et mécanique a été réalisée à l’aide de billes de verre (Lysing matrix tube, MP biomedical) et d’un tampon d’extraction composé de 500 μL de Phénol:Chloroforme:Isoamyl (25:24:1, pH=8,0), 250 μL de hexadecyltrimethylammonium bromide (10% – 0,7 NaCl ; chauffé à 50°C) et 250 μL de K2HPO4/KH2PO4 (240mM). Le mélange est agité au vibro broyeur MM40 de Retsch (30 tours/s, 3min) puis centrifugé (10 min ; 16000 rpm ; 4°C). Les surnageants recueillis dans des microtubes ont été recentrifugés dans les mêmes conditions après un ajout à volume égal de Chloroforme:Isoamyl (24:1). Dans un second temps, les ADN ont été précipités en présence de Poly Ethylène Glycol (PEG6000, 30%, 2 Volume surnageant) et de 5μL de Glycogène pendant 2H à 4°C. Les tubes sont ensuite centrifugés à 18000 rpm à 4 °C. Les culots ont été lavés avec 500μL d’éthanol 70 %, centrifugés pendant 20 min dans les mêmes conditions que précédemment et après séchage à l’air libre pendant 1-2 min, ils ont été remis en suspension dans 50 μL d’H2O Rnase-free. Les qualité et quantité de chaque extrait d’ADN ont été déterminées par mesure de leur absorbance à 280, 230 et 260 nm (Nanodrop ND1000) et par migration (100 V, 30 min) de 5 μl d’extrait sur gel d’agarose 1% (1g d’agarose dans 100mL de Tampon TAE 1X) en présence de 2μL de tampon de charge 6X. Après marquage dans un bain de Bromure d’Ethidium (BET) pendant 10 min, les fragments ADN ont été observés sous UV avec le logiciel VisionCapt.

Amplification & Préparation des librairies pour le séquençage Illumina Les extraits d’ADN à partir d’échantillon de sol peuvent être contaminés par des acides humiques coextraits ainsi que par les composés phénoliques utilisés pendant l’extraction, sont des inhibiteurs de la réaction en chaine de polymérisation (PCR). Pour minimiser ce risque, nous avons effectué des essais de dilutions (1/2, 1/10 et 1/100) sur quelques échantillons pris aléatoirement. Les dilutions et leurs extraits purs respectifs ont été amplifiés avec des amorces spécifiques à des fragments de bactéries, archées et champignons (voir détails ci-dessous). Ces premiers résultats nous ont permis d’appliquer des dilutions 1/100 à tous les extraits pour l’amplification des gènes de bactéries et archées et la dilution 1/2 pour l’amplification des fragments de champignons. Pour la préparation des amplicons, nous avons ciblé les gènes d’ARNr 16S de bactéries et d’archées et la région ‘Internal Transcribed Spacer’ (ITS) des champignons en utilisant respectivement les couples d’amorces suivantes 341F:CCTACGGGNGGCWGCAG et 785R:GACTACHVGGGTATCTAATCC (Quast et al., 2013); 344F:ACGGGGYGCAGCAGGCCGA (Raskin et al., 1994) et 806R:GGACTACVSGGGTATCTAAT (Li et al., 2016); ITS1F:CTTGGTCATTTAGAGGAAGTAA (Buée, Vairelles and Garbaye, 2005) et ITS2:GCTGCGTTCTTCATCGATGC (Feibelman, Bayman and Cibuln, 1994) Chaque primer possédait des adaptateurs Illumina forward (5’-ACACTGACGACATGGTTCTACA-3’) et reverse (5’- TACGGTAGCAGAGACTTGGTCT-3’) nécessaires pour la construction de la librairie réalisée par la plateforme de séquençage. Les volumes respectifs des différents composants du mélange réactionnel d’amplification sont présentés dans le tableau 1 et les conditions d’amplification dans le tableau 2. L’amplification et la taille des fragments ont été vérifiées sur un gel d’agarose 2% (2g d’agarose/ 100 mL de TAE 1X). Les fragments ont migré à 100V pendant 40 min puis ont été révélés aux UV après un bain de BET. Tous les échantillons ont été amplifiés en 2 réplicas indépendants, regroupés sur des plaques 96 puits et envoyés à la plateforme de séquençage Génome Québec au Canada pour séquençage Illumina ‘paired end’ 2 x 300 pb.

Abondances relatives

La figure 7 montre l’abondance relative des bactéries (caractérisées au niveau du phylum) présentes dans le bulk soil et la rhizosphère des L. kerguelensis au sein des différentes stations. Nous avons remarqué que les Actinobactéries, les Chloroflexi, les Protéobactéries, les Acidobactéries et les Verrumicrobies sont les 5 phyla les plus abondants quel que soit la station et le type (rhizosphère ou bulk). Les échantillons bulk montrent des profils assez similaires entre eux alors que nous pouvons observer des différences avec les communautés bactériennes de la rhizosphère. Ainsi, les Actinobactéries, les Protéobactéries et les Planctomycètes sont plus abondantes dans la rhizosphère que dans leur contrôle ‘bulk respectif au sein des stations LON10, PJDA6 et MAC1. En revanche, les Chloroflexi suivent la tendance inverse c’est-à-dire qu’elles sont plus abondantes dans les échantillons bulks que dans la rhizosphère correspondante. Les Verrumicrobies ont des tendances à peu près similaires au sein des stations MAC1 (7,66% dans la rhizosphère et 7,62% dans le bulk) et PJDA6 (5,64% dans la rhizosphère et 5,71% dans le bulk). Contrairement aux stations MAC1 er PJDA6 dans lesquelles l’abondance relative des Verrumicrobies est similaire entre bulk et rhizosphère, au sein de LON10, elle est plus faible dans la rhizosphère que dans le bulk). Les Acidobactéries ne suivent pas les mêmes tendances entre rhizosphère et bulk d’une station à une autre. La station LON30 est géographiquement proche de LON10 mais les deux présentent des compositions bactériennes différentes. RBA5 ne possède pas d’échantillon bulk mais sa rhizosphère présente d’un profil d’abondance bactérienne assez similaire de celui observé dans la rhizosphère des Lyallia échantillonnées à LON10.

Le rapport de stage ou le pfe est un document d’analyse, de synthèse et d’évaluation de votre apprentissage, c’est pour cela rapport-gratuit.com propose le téléchargement des modèles complet de projet de fin d’étude, rapport de stage, mémoire, pfe, thèse, pour connaître la méthodologie à avoir et savoir comment construire les parties d’un projet de fin d’étude.

Table des matières

Introduction
Matériels et Méthodes
Description des stations d’échantillonnage
Echantillonnage
Analyses élémentaires
Extraction d’ADN
Amplification & Préparation des librairies pour le séquençage Illumina
Analyse des séquences
Analyses statistiques
Résultats
Biomasse microbienne du sol et de la rhizosphère de Lyallia kerguelensis dans les différentes stations
Composition des communautés bactériennes dans le sol et la rhizosphère de L. kerguelensis
Composition des communautés fongiques dans le sol et la rhizosphère de L. kerguelensis
Relations avec les nécroses de la plante
Discussion
Biomasse microbienne du sol et de la rhizosphère de Lyallia kerguelensis dans les différentes stations
Composition des communautés bactériennes dans le sol et la rhizosphère de L. kerguelensis
Composition des communautés fongiques dans le sol et la rhizosphère de L. kerguelensis
Relations avec les nécroses de la plante
Perspectives
Conclusions
Références bibliographiques

Rapport PFE, mémoire et thèse PDFTélécharger le rapport complet

Télécharger aussi :

Laisser un commentaire

Votre adresse e-mail ne sera pas publiée. Les champs obligatoires sont indiqués avec *